From teaching

Contents 1 Bioinformatics for Human Biologists - January 2011 1.1 General Information 1.1.1 Where and When 1.1.2 Curriculum 1.1.3 Exam 1.1.4 Hardware / Software used 1.2 Reporting 1.2.1 Exercise hand-ins 1.3 Lecture plan 1.3.1 Monday (Jan 3rd) 1.3.2 Tuesday (Jan 4th) 1.3.3 Wednesday (Jan 5th) 1.3.4 Thursday (Jan 6th) 1.3.5 Friday (Jan 7th) 1.4 Future projects: contact information

Bioinformatics for Human Biologists - January 2011

In 2011 the course runs from monday the 3rd till friday the 7th of january.

Course homepage: Bioinformatics for Human Biologists

General Information

Where and When

January 3rd - 7th, 2011 - Technical University of Denmark (Lyngby Campus): Room 162 / Building 210. Directions on how to get to DTU (Lyngby) and a map of the buildings are found here: DTU Directions.

Curriculum

The curriculum consists of hand-out notes and the computer exercises themselves. There is no formal text-book. All needed reading material will be available online, linked directly from this page. The material can be read on a day-to-day basis.

Exam

The course is pass/fail based on participation (both lectures and exercises).

Hardware / Software used

First and foremost: YOU MUST BRING YOUR OWN LAPTOP TO THE COURSE - wireless access will be provided. For the PyMOL exercise Wednesday, please bring a 3-button / scrollwheel mouse as well.

The computer exercises can be executed from any internet connected computer (Mac, Linux, Windows) with a modern browser (e.g. FireFox, Safari or a recent version of Internet Explorer - a browser which supports tabs is recommended) and Java installed.

Java is used in some exercises to run visualization software. Link: http://www.java.com.

We recommend the JEdit text editor for use on sequence files, since it is well suited for this purpose and is platform independent. Link: http://www.jedit.org.

For the protein structure exercise the PyMOL software (also cross-platform) will be used. Main link: http://www.pymol.org.

Free Student's version:

• Mac version
• Windows version
• Linux version

Reporting

Each group has to keep a "log book" with answers to the questions asked in the exercises. After completing an exercise, mail in the report: raz+humanbio@cbs.dtu.dk

The log book should be kept as minimalistic as possible - the important thing here is to simply focus on giving a nice and simple overview of you answers and not to spent a lot of time on fancy formatting. For example:

Answers to the Multiple Alignment exercise
------------------------------------------
Report by: Rasmus Wernersson (v18103) 

Question 1
----------
Fasta format file: 

>goat_alpha_globin_II
ATGGTGCTGTCTGCCGCCGACAAGTCCAATGTCAAGGCCGCCTGGGGCAAGGTTGGCAGCAACGCTGGAG
CTTATGGCGCAGAGGCTCTGGAGAGGATGTTCCTGAGCTTCCCCACCACCAAGACCTACTTCCCCCACTT
CGACCTGAGCCACGGCTCGGCCCAGGTCAAGGGCCACGGCGAGAAGGTGGCCGCCGCGCTGACCAAAGCG
GTGGGCCACCTGGACGACCTGCCCGGTACTCTGTCTGATCTGAGTGACCTGCACGCCCACAAGCTGCGTG
TGGACCCGGTCAACTTTAAGCTTCTGAGCCACTCCCTGCTGGTGACCCTGGCCTGCCACCACCCCAGTGA
TTTCACCCCCGCGGTCCACGCCTCCCTGGACAAGTTCTTGGCCAACGTGAGCACCGTGCTGACCTCCAAA
TACCGTTAA
>xxx_yyy_qqq
ATAGATAGT ....


Question 2
----------
2a): xxxx yyyy zzzz
2b): ddd jjj uuu

Please note: We collect these answers for two purposes:

1. Assessing participation in the exercises.
2. As a means to improve our teaching, since we get a chance to learn what questions are typically difficult to answer or understand.

Exercise hand-ins

Table of exercise reports that has been mailed in:

• Exercises handed in, 2011

(Will be updated each day)

Lecture plan

Monday (Jan 3rd)

9.15 - 12.00

Lecture: Introduction to the course. DNA and evolution - DNA databases (Rasmus Wernersson)

Readings:

• About Evolution (A reminder, we assume you're all familiar with the basic concepts of evolution).
• About the GenBank database
• About DNA sequencing using the Sanger method

Handouts:

• Chromatogram
• GenBank and FASTA format

Exercise: Searching the GenBank database

13.00 - 16.30

Lecture: Proteins and Protein databases (Rasmus Wernersson/Henrik Nielsen)

Readnings:

• Virtual Ribosome - Computational translation of DNA sequences
• About the UniProt database

Exercises: 1) Virtual translation of DNA sequences, 2) Exploring the UniProt database

Tuesday (Jan 4th)

9.15 - 12.00

Lecture: Pairwise alignment (Anders Gorm Pedersen / Rasmus Wernersson)

Readings: Page 35-55 in Immunological Bioinformatics

Exercise: Pairwise alignment using EBI resources

13.00 - 16.00

Lecture: BLAST - sequence based database searching (Anders Gorm Pedersen / Rasmus Wernersson)

Handouts:

• The BLOSUM62 matrix
• BLASTN heuristics
• BLASTP heuristics

Exercise: Using BLAST - statistics & results

Wednesday (Jan 5th)

9.15 - 12.00/12.30

Lecture: Multiple alignments (Anders Gorm Pedersen / Rasmus Wernersson)

Lecture: Pylogenetic trees (Anders Gorm Pedersen / Rasmus Wernersson)

Readings:

• Review of Multiple Alignment algorithms
• RevTrans - DNA->Protein->DNA alignment
• Introduction to Treebuilding
• Evolutionary trees (except the section "How to reconstruct an evolutionary tree").

Software: Download FigTree from here: http://tree.bio.ed.ac.uk/software/figtree/

Exercises: 1) Multiple alignment, 2) Phylogenetic trees

13.00 - 16.30

Lecture: Protein structure and the PDB database (Thomas Holberg Blicher)

Exercise: Using PyMol for visualizing and analyzing protein 3D structure

Thursday (Jan 6th)

9.15 - 12.00

Lecture: Human Genome Browser (Thomas Nordahl Petersen)

Slides: GenomeBrowser.ppt

Exercise: Genome Browser exercise (PDF)

13.00 - 16.30

Suggested readings:

• File:Face from the past.pdf (PDF)
• SNPs: Variations on a Theme
• Don't put anything smaller than your elbow in your ear

Lecture: Next generation sequencing and assembly (Kasper Nielsen)

Slides: Second generation sequencing (PDF)

Mini-exercise: De-novo assembly

Mini-exercise: Mapping reads to reference genome

Lecture: SNPs and genome-wide association studies (Kasper Nielsen)

Slides: Genome Wide Association Studies (PDF)

Mini-exercise: Comparing GWAS results (NHGRI GWAS catalog)

Lecture: Reconstructing the past: The First Ancient Human Genome (Kasper Nielsen)

Slides: Ancient genome (PDF)

Exercise: From Genotype to Phenotype

Friday (Jan 7th)

9.15 - 12.00

Lecture: Prediction methods in immunological bioinformatics (Claus Lundegaard/Morten Nielsen/Ole Lund)

Readings: page 91 to 102 in Immunological Bioinformatics

Exercise: Prediction methods

13.00 - 16.30

Lecture: PSI-BLAST (Morten Nielsen/Ole Lund/Claus Lundegaard)

Readings: page 68 to 80 in Immunological Bioinformatics

Exercise: Psi-BLAST - hunting for proteins in the twilight-zone

PHYRE EXAMPLE: http://www.sbg.bio.ic.ac.uk/phyre/qphyre_output/38a23a5b367c6340/summary.html

Future projects: contact information

We very much welcome Master Thesis projects from students at the Human Biologist study line (PhD project as well). Such projects are typically coordinated with the individual research group at the Center - a full list is here:

• http://www.cbs.dtu.dk/researchgroups/

Obvious choices for collaboration would for example be the Immunological Bioinformatics, Functional Human Variation and Integrative Systems Biology groups.